We Care Health Services
| Contact Us | Query |
Home Infertility Fertility Surrogacy Genetic Doctors

www.ivfsurrogacy.com
 
 
We Care Health Services IVF, Surrogacy, Surrogacy Mother IVF, Surrogacy, Surrogacy Mother Genetic Treatments for Infertility IVF, Surrogacy, Surrogacy Mother Genetic Treatments for Infertility
 
 
10
Genetic Treatments for Infertility
Karyotyping
FISH
PGD
Genetic Counseling
10
 

10
About Us

10
 

10
About Us
Genetic
Carrying Your Seeds
Loss Of The Fetus
Serious Genetic Disease
Choice For Egg Donation
Send a Quote
IVF Doctors In India
10
 

10
10
 

You are here : Home / Genetic
Text :    

Genetic Treatments for Infertility

What is DNA ?

DNA (deoxyribose nucleic acid) is a code inside cells to tell the body what it needs to function and what to look like. The code is made up of 4 different chemical units called bases. The bases are adenine (A), thymine (T), guanine (G) and cytosine (C). The code, if you were to read it, would look something like this:
...CGTAGCTTACTTTAGGCTAGCAAACGCATC....


A gene is a small section of the code (though much longer than this example) that can be decoded by the cell to mean something. A single gene might be responsible for any aspect of your body's function or appearance, like making a certain protein, or the colour of your eyes.

If there is an error in the code for a gene the product will be faulty (see genetic mistakes). When a cell divides, identical copies of the DNA must be made and distributed evenly into the new cells e.g. when a baby is developing or when we make new blood or skin cells. The copied DNA is packaged into chromosomes and each cell receives an identical copy of each chromosome.

^ Back to Top

What are Chromosomes?

ChromosomesPackaging the DNA into chromosomes ensures that the genetic material is copied and distributed evenly when a cell divides. Chromosomes can only be seen under the microscope when a cell is dividing.

Long strings of DNA, containing hundreds of genes each, coil up in the form of chromosomes. In normal human cells there are 46 chromosomes There is one pair of sex chromosomes (two X chromosomes for females and one X and one Y chromosome for males) and 22 pairs of autosomes (non-sex chromosomes) numbered 1-22.

When a cell divides the DNA is copied and 1 copy of each chromosome is distributed into each new cell (mitosis). The new cells are an identical copy of the previous cell. When producing sperm and eggs, the cells divide so that there are only 23 chromosomes - one of each pair (meiosis).

At fertilization, the chromosomes from the sperm and egg come together to give a new full complement of 46 chromosomes in the embryo. Usually the DNA is copied exactly and the chromosomes are distributed perfectly, but sometimes errors are made by the cell.

^ Back to Top

Genetic Mistakes

Gene errors

Sometimes mistakes can happen in the copying of the code when a cell divides:

Gene deletion

A section of the DNA can be missed out
GTCAACTGATCGATCGGATCGA
GTCAAC___TCGATCGGATCGA


Gene mutation

The wrong base might be copied
GTCAACTGATCGATCGGATCGA
GTCAACTGCTCGATCGGATCGA

Once these errors are made, the gene may be faulty and not function properly. It may cause a genetic disease, such as cystic fibrosis. The faulty gene will be copied exactly and can be passed down from generation to generation.

Chromosome errors

Chromosome loss or gain.
Chromosomeloss LossWhen a cell is dividing, sometimes a whole chromosome can end up in the wrong cell, so that the cell has the wrong number of chromosomes (aneuploidy). One cell will have one too many chromosomes (chromosome gain) and one will have one too few (chromosome loss).

If there is an extra chromosome, the cells have extra DNA and if there is one missing there will be less. This is rather like having either too many or not enough ingredients for a recipe.

These mistakes can happen when any cell is dividing but if they occur during the formation of sperm and eggs cells, it will affect the genetic makeup of the embryo.

You may be familiar with Down syndrome that is caused by having an extra copy of chromosome 21. This gives 3 copies in total and Down syndrome is sometimes called trisomy 21

^ Back to Top

Chromosome Rearrangement

Usual segregation of chromosomes into gametesPieces of chromosomes can sometimes be rearranged, so that one piece of a chromosome is stuck on another (translocation) A handy way to think about this is if you imagine that you have two complete sets of Encyclopaedia Britannica in your house, stored in a very orderly fashion.

If, for some reason, the order of the two sets of books is rearranged, it doesn't bother you, because you still have 2 copies of all the volumes.

But if you then swapped a set of the books with someone else, not realising that their order had been changed, you might find yourself with two copies of volume 6, but none of volume 11! This is very irritating if you need to know something in Volume 11. Imagine if the information in that book was crucial for your survival, as is almost always the case with chromosomes.

If you have a translocation it would not affect you, because you would still have all the information you need, just in a different order.

But then, when you produce sperm or eggs, which only have half the number of chromosomes as the rest of your cells, the matching chromosome pieces could get separated during the cell divisions. You could end up with the right combination if the sperm or egg receives one of each pair with the rearrangement or one of each pair not rearranged.

You could end up with the wrong combination if the sperm or egg receives one of the pair with the rearrangement and one of the pair not rearranged.

Then the egg or sperm wouldn't have all the information it needs. The wrong dose of chromosomes will usually result in failed implantation, miscarriage, or an abnormality in the baby.

How do we test DNA




^ Back to Top

For more information, medical assessment and medical quote
send your detailed medical history and medical reports
as email attachment to
Em@il : - info@wecareindia.com
Call: +91 9029304141 (10 am. To 8 pm. IST)
(Only for international patients seeking treatment in India)
You are here : Home / Genetic
     
sideBar
Send Response
 
         
         
         
  
Go Back Print This Page
Success
Other Procedures
India
Know More
For Professionals
Resources
Success Rates
Success Rates By Age
Happy Families
Pre Treatment Investigation
Laparoscopy Procedures
Cord Blood Banking
About India
Medical Tourism
Medical Visa
Stay in India
FAQ's
Facilities
Fully Inclusive Prices
IVF Centres
Be Our Associate
Corporates
Insurance
Refer a Patient
Affiliations
IVF News
Links
Blogs
Useful Info
Glossary
Related Links

Home   |   About Us   |   Site Map   |   Get a Quote  |   Disclaimer   |  Advertise With Us   |   Contact Us
Copyright SURROGACYNEEDS.COM All rights reserved. THESE NUTS IN YOUR FACE BITCH

Valid HTML 4.01 Transitional Valid CSS! Digg Me !

Genetic Infertility Treatment Cost India, Genetic Infertility Treatment India Cost India Cost India, Genetic Infertility Treatment India Cost India, Genetic India Cost India, PGD India Cost India, Genetic India Cost India, Define DNA India Cost India, Genetic Mistakes India Cost India, Genetic Problems India Cost India, Chromosomes India Cost India, Chromosome Rearrangement India Cost India, Sperm Cost India, Egg Cost India, Karyotyping Cost India, FISH Cost India, PGD Cost India, Cost India, Humans Genetics Cost India, Genetics Disorders Cost India, Genetics Health Information Cost India, Genetic Disorders Cost India, Genetics Counseling Cost India, X Chromosome Cost India, Y Chromosomes Cost India, Genetic Tests Cost India, Infertility Treatment For Genetic Disorders